| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.249375 |
| Chromosome: | chromosome 7 |
| Location: | 1059616 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g319650 | FXL4,FXL5 | FixL-like PAS domain protein; (1 of 3) IPR000014//IPR013767 - PAS domain // PAS fold | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CACCGGCCAGCAGATCGCGCCGCCACAACG |
| Internal bar code: | GCTCAGCGGGGGCATCGTTGTG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 365 |
| LEAP-Seq percent confirming: | 98.913 |
| LEAP-Seq n confirming: | 91 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTGATGTGCAGGTCAACAGG |
| Suggested primer 2: | TCCTCTGTTCGGTATCCCTG |