| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.249530 |
| Chromosome: | chromosome 6 |
| Location: | 7761768 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g302200 | EFH3 | (1 of 1) PF13202//PF14252 - EF hand (EF-hand_5) // Domain of unknown function (DUF4347) (DUF4347); EF-hand Calcium binding protein with DUF4346 domain | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCACTCTGCGTGGGCAGCTGAGGAGCTGCA |
| Internal bar code: | CTGTTTTGACCATTCGCTAGTG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 580 |
| LEAP-Seq percent confirming: | 99.6016 |
| LEAP-Seq n confirming: | 250 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACGGAAACAGTATGAACGCC |
| Suggested primer 2: | AGTGTGCCCTTACCGTTGAC |