| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.249677 |
| Chromosome: | chromosome 12 |
| Location: | 5630064 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g532200 | AOA2 | Putative alcohol O-acetyltransferase; (1 of 4) 2.3.1.84 - Alcohol O-acetyltransferase / AATASE | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCGTGGCCGCGCCGCACATACATCACGCTG |
| Internal bar code: | CGCAGCCAGACGAAGTGCCTT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 393 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 341 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 9 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGCAGGGTCAAGCATAGAAC |
| Suggested primer 2: | TCTCCTAGCGCTTCTTGAGC |