| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.249841 |
| Chromosome: | chromosome 10 |
| Location: | 3898109 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g447800 | (1 of 3) K11089 - 60 kDa SS-A/Ro ribonucleoprotein (TROVE2, SSA2) | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGAGTATTGTGCGATGTGTGAAAGCGTTGC |
| Internal bar code: | GTAATTGGGATTATAATTCGGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 474 |
| LEAP-Seq percent confirming: | 98.6637 |
| LEAP-Seq n confirming: | 443 |
| LEAP-Seq n nonconfirming: | 6 |
| LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCTTGTGCACTTGACACGTT |
| Suggested primer 2: | GTCCCTTAGGTGAATGCGAA |