Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.RY0402.249932 |
Chromosome: | chromosome 12 |
Location: | 1415504 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre12.g488000 | FFT4 | putative fructan fructosyltransferase; (1 of 2) 2.4.1.99 - Sucrose:sucrose fructosyltransferase / Sucrose:sucrose 1-fructosyltransferase | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GAGCCTACTTAGCGCATGCAAGTAGCCATG |
Internal bar code: | GGGGTGAGAAGGTGATGCTAG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 249 |
LEAP-Seq percent confirming: | 99.3243 |
LEAP-Seq n confirming: | 147 |
LEAP-Seq n nonconfirming: | 1 |
LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | AATGTGGGTCTTAACGCCTG |
Suggested primer 2: | CAGGGAGCTTTGTCAGAAGG |