| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.249972 |
| Chromosome: | chromosome 16 |
| Location: | 5176798 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g683250 | (1 of 1) PF05832 - Eukaryotic protein of unknown function (DUF846) (DUF846) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTCTGTTAGCCAAACGCTAGCCGCTGCCAC |
| Internal bar code: | AGTTGGATATTTACTCTGTTTA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1115 |
| LEAP-Seq percent confirming: | 99.4894 |
| LEAP-Seq n confirming: | 1364 |
| LEAP-Seq n nonconfirming: | 7 |
| LEAP-Seq n unique pos: | 7 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TTTGGGTTTCCTATTCGTGC |
| Suggested primer 2: | ATCCTGGCCTGTATCATTGC |