Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.249985 |
Chromosome: | chromosome 1 |
Location: | 4321220 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre01.g029200 | DIV30,ESP1 | Separase, cell cycle protease; (1 of 1) 3.4.22.49 - Separase / Separin | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTGTTTGATGCTCGGATAGCAGCACTCTGT |
Internal bar code: | TGGGGACGATAAAAAGATAAA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 627 |
LEAP-Seq percent confirming: | 99.6212 |
LEAP-Seq n confirming: | 263 |
LEAP-Seq n nonconfirming: | 1 |
LEAP-Seq n unique pos: | 16 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TTTATGCTCTCAAACGCACG |
Suggested primer 2: | CCAGCCCAAACTAAACCAAA |