| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.250039 |
| Chromosome: | chromosome 17 |
| Location: | 3516233 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre17.g725200 | (1 of 2) K05658 - ATP-binding cassette, subfamily B (MDR/TAP), member 1 (ABCB1) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGCATCCTCCGGTTTCCCACCTAGGCTGCG |
| Internal bar code: | TTAAGACTGTTGGAACGTGCG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 563 |
| LEAP-Seq percent confirming: | 98.4283 |
| LEAP-Seq n confirming: | 501 |
| LEAP-Seq n nonconfirming: | 8 |
| LEAP-Seq n unique pos: | 7 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTTGAGGCAGATGGTGGTTT |
| Suggested primer 2: | GCGTGGGGCTAGTGATTAAA |