| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.250374 |
| Chromosome: | chromosome 10 |
| Location: | 1184256 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g426152 | MGL1 | Methionine gamma-lyase; (1 of 1) K01761 - methionine-gamma-lyase (E4.4.1.11) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGCAAAGGGGGAGTGAGACGAACCGGTGTG |
| Internal bar code: | AGTGGAATATCGATCCGCACG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 148 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 11 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGTCGTCCCAGTTTCCACAC |
| Suggested primer 2: | GTCAGCCCAAGAGAACTTCG |