| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.250542 |
| Chromosome: | chromosome 2 |
| Location: | 7896295 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g141450 | UBC14 | (1 of 1) K10688 - ubiquitin-conjugating enzyme E2 W (UBE2W, UBC16); E2 Ubiquitin conjugating enzyme | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCAACCTATATGGTGCTGTCCCAGTAAGGG |
| Internal bar code: | GCACTACCTGAGTCGTGCATGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 677 |
| LEAP-Seq percent confirming: | 99.4835 |
| LEAP-Seq n confirming: | 5586 |
| LEAP-Seq n nonconfirming: | 29 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TTTGGTCAAGGACTAACGGG |
| Suggested primer 2: | ACTGGGTGTTTGAGGACGAC |