| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.250543 |
| Chromosome: | chromosome 3 |
| Location: | 4894777 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g179500 | PHX8,P4H13,PFH13 | (1 of 2) PTHR10869:SF66 - OXIDOREDUCTASE, 2OG-FE(II) OXYGENASE FAMILY PROTEIN-RELATED; Prolyl 4-hydroxylase 13 | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGTCGTGCCGCCACCACACCATCTTGGTCT |
| Internal bar code: | GGTTTCGGGCTGGGCCGAATGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 117 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 104 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTGTGAAGTAATCAGCGGCA |
| Suggested primer 2: | AGGCTTAGGCTTGGCTTAGG |