Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.250583 |
Chromosome: | chromosome 3 |
Location: | 3864314 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre03.g171000 | (1 of 1) IPR003072//IPR006569//IPR008942 - Orphan nuclear receptor, NOR1 type // CID domain // ENTH/VHS | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGGTTTAACACGCCTGGGTGGGCTTCGTTT |
Internal bar code: | TTCGGATGCGGTTTTGATGGG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 413 |
LEAP-Seq percent confirming: | 97.9779 |
LEAP-Seq n confirming: | 533 |
LEAP-Seq n nonconfirming: | 11 |
LEAP-Seq n unique pos: | 8 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CACACATGTGCACCAATCAA |
Suggested primer 2: | GCAGCAGCAGCAGTAGTAGC |