| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.250618 |
| Chromosome: | chromosome 12 |
| Location: | 4381599 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g520450 | SGT1 | Serine O-galactosyltransferase 1; (1 of 1) PTHR31485:SF7 - PEPTIDYL SERINE ALPHA-GALACTOSYLTRANSFERASE | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACTGACTGGTCCCACGTGGCCGCTGCTCCG |
| Internal bar code: | ACCATCCCTCCGCGGTCCAAC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 389 |
| LEAP-Seq percent confirming: | 99.1597 |
| LEAP-Seq n confirming: | 354 |
| LEAP-Seq n nonconfirming: | 3 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AACAGGGAAATGGTGCTGAC |
| Suggested primer 2: | TGATGCCAGTGCACCTAGAG |