Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.250869 |
Chromosome: | chromosome 12 |
Location: | 7327070 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre12.g557350 | FAO9 | (1 of 1) PF00355//PF01266 - Rieske [2Fe-2S] domain (Rieske) // FAD dependent oxidoreductase (DAO); FAD-dependent oxidoreductase | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCGACGGACCCGCCCATCTGCCGTACGCAC |
Internal bar code: | GAAATAGCCGGACATGCCAGCG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 293 |
LEAP-Seq percent confirming: | 99.0196 |
LEAP-Seq n confirming: | 101 |
LEAP-Seq n nonconfirming: | 1 |
LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | ATCCCCGAACTCCTCTCTGT |
Suggested primer 2: | GAGGGAGATCGGTAGGGAAG |