| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.250983 |
| Chromosome: | chromosome 3 |
| Location: | 3344040 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g166600 | DIV147 | (1 of 1) PTHR13366//PTHR13366:SF0 - MALARIA ANTIGEN-RELATED // HEAT REPEAT-CONTAINING PROTEIN 6 | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGCTCTCGTGTGTTTGCGATGATCGCACGC |
| Internal bar code: | CGATAGACCCGCGCGGCGGCT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 853 |
| LEAP-Seq percent confirming: | 98.881 |
| LEAP-Seq n confirming: | 6539 |
| LEAP-Seq n nonconfirming: | 74 |
| LEAP-Seq n unique pos: | 139 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGCAATCAAAAGAACGCAAG |
| Suggested primer 2: | GTCTGTTGCTCCCACATCCT |