| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.250995 |
| Chromosome: | chromosome 16 |
| Location: | 1116438 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g649833 | (1 of 1) IPR001841//IPR003903 - Zinc finger, RING-type // Ubiquitin interacting motif | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACCCTGTGTGTCCGCGGTTGCGGCAAGACT |
| Internal bar code: | CACTACACCCTCTCGAGTCGTG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 653 |
| LEAP-Seq percent confirming: | 92.9354 |
| LEAP-Seq n confirming: | 763 |
| LEAP-Seq n nonconfirming: | 58 |
| LEAP-Seq n unique pos: | 14 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AACGAAAAGGTTTTGTTGCG |
| Suggested primer 2: | GCAAGCACGATAACGAGGAT |