| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.251007 |
| Chromosome: | chromosome 8 |
| Location: | 1283014 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre08.g363600 | TPT12,TPT11 | UMAMIT (Usually Multiple Acids Move In and Out Transporters) type transporter; (1 of 27) PF03151 - Triose-phosphate Transporter family (TPT) | 5'UTR_intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GATGTTTTAGAGCGGTCGAACTGAGGGGAA |
| Internal bar code: | AGCGTGTTTGGGGACACTAGAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 615 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 1 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CACCTTCTTAGCCTTGGCAG |
| Suggested primer 2: | TACAGATCGCTAGTGTGCCG |