Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.251210 |
Chromosome: | chromosome 6 |
Location: | 2157648 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre06.g265850 | TCP2,CTPA2,TSP2,CTPC1 | C-terminal peptidase C; (1 of 1) PTHR32060//PTHR32060:SF8 - FAMILY NOT NAMED // PEPTIDASE S41 FAMILY PROTEIN | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTGGCGTGGTTGCAGCTCGAGGCGCGGCTG |
Internal bar code: | GGCCATTCAGCGGAGGGATTTC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 526 |
LEAP-Seq percent confirming: | 99.4152 |
LEAP-Seq n confirming: | 1700 |
LEAP-Seq n nonconfirming: | 10 |
LEAP-Seq n unique pos: | 30 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | AGCAGCATCAGCAGTAGCAA |
Suggested primer 2: | CTCTTCCCTCGCACCTGTAG |