| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.251252 |
| Chromosome: | chromosome 13 |
| Location: | 3198265 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre13.g585550 | HAP2 | (1 of 12) IPR000326 - Phosphatidic acid phosphatase type 2/haloperoxidase; Putative haloperoxidase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGCACCCCTACCTGCTTGGTGCCCTCCTGC |
| Internal bar code: | CGCGGGCTGCGTCACTATGCTT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 565 |
| LEAP-Seq percent confirming: | 99.8049 |
| LEAP-Seq n confirming: | 3070 |
| LEAP-Seq n nonconfirming: | 6 |
| LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGACAATGGCTCACTTGCTA |
| Suggested primer 2: | CTGCATAGCCTACTCCCTCG |