| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.251305 |
| Chromosome: | chromosome 2 |
| Location: | 3439276 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g095114 | (1 of 228) IPR029063 - S-adenosyl-L-methionine-dependent methyltransferase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACCGTGTGGTGAACCCGAGCCCATCCCGCT |
| Internal bar code: | ACTCGCTTCAGCGCCGGGCGTA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 238 |
| LEAP-Seq percent confirming: | 87.3229 |
| LEAP-Seq n confirming: | 1233 |
| LEAP-Seq n nonconfirming: | 179 |
| LEAP-Seq n unique pos: | 9 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TTTCAATCCGTACTGGCCTC |
| Suggested primer 2: | CGAGTGGCGGTAGGTTGTAT |