| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.251366 |
| Chromosome: | chromosome 3 |
| Location: | 1834124 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g154550 | PCR1,P5CR1 | Pyrroline-5-carboxylate reductase; (1 of 1) 1.5.1.2 - Pyrroline-5-carboxylate reductase / P5CR | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GACGGAGCAGCAGCAGCAGCAGCAGCAGCA |
| Internal bar code: | TGTACCGCCACCGGCGGCGCCG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 565 |
| LEAP-Seq percent confirming: | 99.4126 |
| LEAP-Seq n confirming: | 3385 |
| LEAP-Seq n nonconfirming: | 20 |
| LEAP-Seq n unique pos: | 58 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCTCAAGGACATGGTCACCT |
| Suggested primer 2: | CATTCTGGCTGTGCTTACGA |