| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.251400 |
| Chromosome: | chromosome 10 |
| Location: | 4250665 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g450350 | Hspb11,FAP232,IFT25 | Intraflagellar Transport Protein 25; (1 of 1) K19369 - heat shock protein beta-11 (HSPB11) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTGGCGCGGATGTTGACCTGATGCACCTCC |
| Internal bar code: | CCTATTGCTCTGCCCCGCCGTG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 738 |
| LEAP-Seq percent confirming: | 98.8696 |
| LEAP-Seq n confirming: | 1137 |
| LEAP-Seq n nonconfirming: | 13 |
| LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TTCCTTTCCGCTCTGGTCTA |
| Suggested primer 2: | GGTGCATTGTGACGTGATTC |