| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.251436 |
| Chromosome: | chromosome 10 |
| Location: | 3663469 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g445850 | MAE14 | (1 of 11) K03327 - multidrug resistance protein, MATE family (TC.MATE, SLC47A, norM, mdtK, dinF); MATE efflux family protein | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AATGTCGTAGGTCGCTCGCTCGAAGGCGCA |
| Internal bar code: | AGATCTATTTAGATCTTTTGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 709 |
| LEAP-Seq percent confirming: | 99.3701 |
| LEAP-Seq n confirming: | 631 |
| LEAP-Seq n nonconfirming: | 4 |
| LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CAGGCTGCCCACACTATGTA |
| Suggested primer 2: | GCAGGAGTTCTTGGCTTCAC |