Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.RY0402.251438 |
Chromosome: | chromosome 12 |
Location: | 728987 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre12.g495100 | PSR1 | (1 of 1) PF00249//PF14379 - Myb-like DNA-binding domain (Myb_DNA-binding) // MYB-CC type transfactor, LHEQLE motif (Myb_CC_LHEQLE); Phosphorus starvation response 1 | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AAGAATGGTACAATGGCCGGCCCGAGCAGC |
Internal bar code: | TTTGGTCGGAACGCTCATACAG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 82 |
LEAP-Seq percent confirming: | 99.7355 |
LEAP-Seq n confirming: | 377 |
LEAP-Seq n nonconfirming: | 1 |
LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CGCATGCATCTGTTGACTCT |
Suggested primer 2: | TCATGACAATAGCGCGTCTC |