| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.251438 |
| Chromosome: | chromosome 12 |
| Location: | 4808067 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g524450 | PTP3 | Protein tyrosine phosphatase; (1 of 1) PF00102//PF00782 - Protein-tyrosine phosphatase (Y_phosphatase) // Dual specificity phosphatase, catalytic domain (DSPc) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGCTTGGCACAGTGCTCGCCCTGTCGGGAC |
| Internal bar code: | AGTTGAACTAGCGTCTCATTCT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 471 |
| LEAP-Seq percent confirming: | 99.3322 |
| LEAP-Seq n confirming: | 595 |
| LEAP-Seq n nonconfirming: | 4 |
| LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCCTTCAGTAATGCCACGTT |
| Suggested primer 2: | TTTGTACGGAACCGCCTAAC |