Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.251468 |
Chromosome: | chromosome 16 |
Location: | 3905165 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre16.g690450 | FAP266 | Flagellar Associated Protein 266; (1 of 1) PTHR23084//PTHR23084:SF143 - PHOSPHATIDYLINOSITOL-4-PHOSPHATE 5-KINASE RELATED // SUBFAMILY NOT NAMED | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTGACACGAAGGGGGAAACGCAATGGCCAT |
Internal bar code: | GCACGACCCAGCTTGGGGCAGT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 268 |
LEAP-Seq percent confirming: | 98.3083 |
LEAP-Seq n confirming: | 523 |
LEAP-Seq n nonconfirming: | 9 |
LEAP-Seq n unique pos: | 12 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CAAATGGTGCAACACTGGTC |
Suggested primer 2: | GTGGGGGAGAGGGTTACATT |