| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.251471 |
| Chromosome: | chromosome_5 |
| Location: | 1189385 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Orientation | Feature |
|---|---|---|---|---|
| Cre05.g245500 | FAP175,ANK24 | Flagellar Associated Protein with ankyrin repeats | sense | intron |
Insertion site details | |
| Flanking sequence (orientation from cassette outwards): | GCTAGCCGTAGCGCGAGTAACGTCACACAC |
| Internal bar code: | CCACGGTCCAGGTTTGTGTATC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 517 |
| LEAP-Seq percent confirming: | 99.5954 |
| LEAP-Seq n confirming: | 5415 |
| LEAP-Seq n nonconfirming: | 22 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCTTAGTCTGCGCTGTGATG |
| Suggested primer 2: | GCCTATGGGACTGCCTATCA |