| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.251541 |
| Chromosome: | chromosome 10 |
| Location: | 1230340 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g426600 | CYP739A6,CYP27 | Cytochrome P450, CYP213 superfamily; (1 of 8) PTHR24286//PTHR24286:SF77 - FAMILY NOT NAMED // ABSCISIC ACID 8'-HYDROXYLASE 4 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCACTCATCAGCTCACCCATCCGCTCACGC |
| Internal bar code: | AAGGTTGATGGTCTAAGATTTG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 548 |
| LEAP-Seq percent confirming: | 99.5763 |
| LEAP-Seq n confirming: | 705 |
| LEAP-Seq n nonconfirming: | 3 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGGGGAGTTGACTCTATCCA |
| Suggested primer 2: | CCGACACGAACAACATCAAC |