| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.251558 |
| Chromosome: | chromosome 12 |
| Location: | 5871893 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g533800 | CYN22 | Cyclophilin 22; (1 of 1) K09567 - peptidyl-prolyl isomerase H (cyclophilin H) (PPIH, CYPH) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTTCAACTCCTTAAGGATTGCCCGTTGACG |
| Internal bar code: | TATCCAGTTGGGCAGCTTTAAT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 390 |
| LEAP-Seq percent confirming: | 64.42 |
| LEAP-Seq n confirming: | 2227 |
| LEAP-Seq n nonconfirming: | 1230 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACATCTCCCCACACTCCTTG |
| Suggested primer 2: | GGGCTACCAGTCGGATACAA |