| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.251585 |
| Chromosome: | chromosome 2 |
| Location: | 1139639 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g081550 | HAD | Putative 3-hydroxyacyl-ACP dehydratase (mitochondrial FAS); (1 of 1) K18532 - adenylate kinase (AK6, FAP7) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCCACCCCTAACTGCACGCTAACCGCAAGT |
| Internal bar code: | CTTAACTTGTTTTATTGCGGGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1 |
| LEAP-Seq percent confirming: | 42.9044 |
| LEAP-Seq n confirming: | 1037 |
| LEAP-Seq n nonconfirming: | 1380 |
| LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGAATTTAGCCATAGGGGCG |
| Suggested primer 2: | TCCGTGTTGTCACTGGACAT |