Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | - |
Strain: | LMJ.RY0402.251599 |
Chromosome: | chromosome 3 |
Location: | 8273989 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre03.g199300 | AHA1 | (1 of 1) PF08327//PF09229 - Activator of Hsp90 ATPase homolog 1-like protein (AHSA1) // Activator of Hsp90 ATPase, N-terminal (Aha1_N); Activator of HSP90 ATPase homolog 1 | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTGGTACCGGATGCATGTGTCCGGGTGACG |
Internal bar code: | CCCCAACTACGCAGCGCGTCTC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1303 |
LEAP-Seq percent confirming: | 99.8693 |
LEAP-Seq n confirming: | 6112 |
LEAP-Seq n nonconfirming: | 8 |
LEAP-Seq n unique pos: | 9 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CATGCCACCACTATCACGTC |
Suggested primer 2: | AAGGCGGAGAAGGAGAAGTC |