| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.251609 |
| Chromosome: | chromosome 10 |
| Location: | 1287381 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g427300 | PF24,RSP2 | Radial Spoke Protein 2; (1 of 1) PTHR23356//PTHR23356:SF5 - DPY30-RELATED // SUBFAMILY NOT NAMED | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTGTCATCGCTTGCCCGGCATCTAATCGCC |
| Internal bar code: | TCTTTTTCGCGAGCTGTCGCGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 803 |
| LEAP-Seq percent confirming: | 97.3881 |
| LEAP-Seq n confirming: | 522 |
| LEAP-Seq n nonconfirming: | 14 |
| LEAP-Seq n unique pos: | 19 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGCTAGAGGACAGGAAGTGG |
| Suggested primer 2: | AAACTTGACTTGGTGGGTGC |