| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.251672 |
| Chromosome: | chromosome 17 |
| Location: | 2755166 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre17.g718450 | MMP2 | Matrix metalloproteinase; (1 of 1) IPR003108 - Growth-arrest-specific protein 2 domain | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AACCGTGGGCCGCACCCACGGCCGCACCCG |
| Internal bar code: | CCCCGCGGGGTCATGCGTAATG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 79 |
| LEAP-Seq percent confirming: | 75.7143 |
| LEAP-Seq n confirming: | 53 |
| LEAP-Seq n nonconfirming: | 17 |
| LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGTGGCACATCACAATAAGG |
| Suggested primer 2: | GGCGAGCACATGGAGAATAC |