| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.251689 |
| Chromosome: | chromosome 12 |
| Location: | 7814553 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g553450 | CNG1 | Cyclic-nucleotide gated potassium channel; (1 of 7) PF00027//PF00520 - Cyclic nucleotide-binding domain (cNMP_binding) // Ion transport protein (Ion_trans) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGACGCATCCCCTTCCTGCAGAGCCCGGGA |
| Internal bar code: | GGGAGGACCATCGGGTGGCAGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 428 |
| LEAP-Seq percent confirming: | 96.3783 |
| LEAP-Seq n confirming: | 479 |
| LEAP-Seq n nonconfirming: | 18 |
| LEAP-Seq n unique pos: | 12 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGCTCCTTCTGTTTGGACTC |
| Suggested primer 2: | ATTTCCCCCACGCTAATACC |