Insertion junction: LMJ.RY0402.251728_2

Overview

Insertion cassette:CIB1
Side of cassette:5'
Strand:-
Strain:LMJ.RY0402.251728
Chromosome:chromosome_8
Location:4145144
Confidence (%):95
Locus disrupted Locus common name Defline Orientation Feature
Cre08.g379900 sense intron

Insertion site details

Flanking sequence (orientation from cassette outwards):ACAACTCCATGCATACCGACACATGCACAT
Internal bar code:CTTCCGGATATACGCGCTTCCA

Confirmation - LEAP-Seq

LEAP-Seq distance:227
LEAP-Seq percent confirming:97.2477
LEAP-Seq n confirming:212
LEAP-Seq n nonconfirming:6
LEAP-Seq n unique pos:2

Suggested primers for confirmation by PCR

Suggested primer 1:AGGTGTGTGACAAGGGGAAG
Suggested primer 2:ACAGATGAACACCACCACGA