| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.251858 |
| Chromosome: | chromosome 9 |
| Location: | 4151833 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g393954 | FAP106 | Flagellar Associated Protein 106; (1 of 1) PTHR21490:SF0 - ENKURIN | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCTAGGCAGTGACAGTGGTCGCTGTTTTAC |
| Internal bar code: | AGTGAATTGCTTCGGTGGTTAC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 825 |
| LEAP-Seq percent confirming: | 99.3477 |
| LEAP-Seq n confirming: | 3046 |
| LEAP-Seq n nonconfirming: | 20 |
| LEAP-Seq n unique pos: | 10 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGATCGAGTGTGTCGCTTTC |
| Suggested primer 2: | CATTGGCACTTTCCCGTAGT |