Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.251906 |
Chromosome: | chromosome 14 |
Location: | 1579726 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre14.g618750 | FAP246 | Flagellar Associated Protein 246; (1 of 1) IPR001611//IPR002048//IPR002931//IPR003591 - Leucine-rich repeat // EF-hand domain // Transglutaminase-like // Leucine-rich repeat, typical subtype | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTGAAATATTGGGAACAGGATACTGGGAAT |
Internal bar code: | CTGCCTCTTCGACCCCCCCAA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 541 |
LEAP-Seq percent confirming: | 96.6173 |
LEAP-Seq n confirming: | 457 |
LEAP-Seq n nonconfirming: | 16 |
LEAP-Seq n unique pos: | 32 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CCTCCTCCTCAGGTGTGGT |
Suggested primer 2: | CTCAAGGGAACAGAAGCAGG |