Insertion junction: LMJ.RY0402.252073_1

Overview

Insertion cassette:CIB1
Side of cassette:3'
Strand:+
Strain:LMJ.RY0402.252073
Chromosome:chromosome_13
Location:1616798
Confidence (%):73
Locus disrupted Locus common name Defline Orientation Feature
Cre13.g573500 FAP95 Flagellar Associated Protein sense intron

Insertion site details

Flanking sequence (orientation from cassette outwards):GTGGGTTCTTCGCGAGTGCGGCATTCAGCT
Internal bar code:ATGTAACGTCGGGCGTGAGAGG

Confirmation - LEAP-Seq

LEAP-Seq distance:523
LEAP-Seq percent confirming:96.7391
LEAP-Seq n confirming:89
LEAP-Seq n nonconfirming:3
LEAP-Seq n unique pos:6

Suggested primers for confirmation by PCR

Suggested primer 1:TGCATCTGCATGTGCTTACA
Suggested primer 2:CACCACTCCGACGGTAACTT