Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.252194 |
Chromosome: | chromosome 1 |
Location: | 6651905 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre01.g047700 | CYN40 | Cyclophilin 40; (1 of 2) K05864 - peptidyl-prolyl isomerase D [EC:5.2.1.8] (PPID, CYPD) | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CATTACCCGACACCCGCCGTACCCCAGGCT |
Internal bar code: | GACGAACTTGTTTACACGGGTC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 443 |
LEAP-Seq percent confirming: | 96.25 |
LEAP-Seq n confirming: | 231 |
LEAP-Seq n nonconfirming: | 9 |
LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | ACCCTCTGCTCTTGCCTGTA |
Suggested primer 2: | GTATGTTGGTTCTTCCGCGT |