| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.252229 |
| Chromosome: | chromosome 4 |
| Location: | 257587 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre04.g217550 | EIF3C | (1 of 1) K03252 - translation initiation factor 3 subunit C (EIF3C); Eukaryotic translation initiation factor 3, subunit C | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTAAATGGTCGTGTGCATAATCAGCAGACC |
| Internal bar code: | TAGCTACTCTAGGGGATTAATA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 581 |
| LEAP-Seq percent confirming: | 97.0803 |
| LEAP-Seq n confirming: | 1197 |
| LEAP-Seq n nonconfirming: | 36 |
| LEAP-Seq n unique pos: | 22 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ATATGGCAAACCAATCAGGC |
| Suggested primer 2: | TGTGTTTGTGTGGTTGGCTT |