| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.252236 |
| Chromosome: | chromosome 7 |
| Location: | 2661071 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g330700 | FAP91,Cam-IP2 | Flagellar Associated Protein 91; (1 of 1) PF14738 - Solute carrier (proton/amino acid symporter), TRAMD3 or PAT1 (PaaSYMP) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCGCAACATCATGGCCAACGGCGACGAGGC |
| Internal bar code: | ACACCCCGGCTTGCGAACCGGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 0 |
| LEAP-Seq percent confirming: | 98.6487 |
| LEAP-Seq n confirming: | 73 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTGTACTGGTCCTGGAACGC |
| Suggested primer 2: | GACGGTGAGCATTTGGCTAT |