Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.252260 |
Chromosome: | chromosome 12 |
Location: | 697325 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre12.g494850 | ADK3 | Adenylate kinase; (1 of 1) PTHR23359//PTHR23359:SF72 - NUCLEOTIDE KINASE // ADENYLATE KINASE FAMILY PROTEIN | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTGCCAGGTGACGGCGCTTTATGTCATGGC |
Internal bar code: | GATAGCTAGTTGGTCCCTACAT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 66 |
LEAP-Seq percent confirming: | 9.35961 |
LEAP-Seq n confirming: | 38 |
LEAP-Seq n nonconfirming: | 368 |
LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GGCATTCTAGCTCAAGCCAC |
Suggested primer 2: | AGGTTGATAACATCCAGGCG |