| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.252264 |
| Chromosome: | chromosome 7 |
| Location: | 2226908 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g327300 | (1 of 3) PF13815 - Iguana/Dzip1-like DAZ-interacting protein N-terminal (Dzip-like_N) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTACATGCATCCCCTGAAGAGACACAGTCA |
| Internal bar code: | TGTCGCTCCATCGTCGCAGCGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 507 |
| LEAP-Seq percent confirming: | 99.2278 |
| LEAP-Seq n confirming: | 514 |
| LEAP-Seq n nonconfirming: | 4 |
| LEAP-Seq n unique pos: | 8 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AAGCAAGTAAGGCAACGCAT |
| Suggested primer 2: | CTCTTCTCTGCGGAGTCACC |