Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.252275 |
Chromosome: | chromosome 16 |
Location: | 1986844 |
Confidence (%): | 58 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre16.g656650 | PGP8 | (1 of 1) PTHR18901//PTHR18901:SF30 - 2-DEOXYGLUCOSE-6-PHOSPHATE PHOSPHATASE 2 // SUBFAMILY NOT NAMED; Phosphoglycolate phosphatase/2-deoxygucose-6-phosphate phosphatase | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CACCGCCGGCATCTGGCCAGCGCCCGCGCG |
Internal bar code: | GGGGAGGGGGCAGCGAGCATAG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 437 |
LEAP-Seq percent confirming: | 96.8561 |
LEAP-Seq n confirming: | 801 |
LEAP-Seq n nonconfirming: | 26 |
LEAP-Seq n unique pos: | 10 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TGCCACCACACAAAGGTTTA |
Suggested primer 2: | GGGCTACTCCATGCCAATAA |