| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.252319 |
| Chromosome: | chromosome 8 |
| Location: | 4208048 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre08.g380400 | MAD2 | (1 of 1) K02537 - mitotic spindle assembly checkpoint protein MAD2 (MAD2); Mitotic spindle assembly checkpoint protein | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGAGAATCAATGTCTAGGCTAGGACCGTAT |
| Internal bar code: | CGTTACTGTTTTTCTGTGTATC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 408 |
| LEAP-Seq percent confirming: | 99.4749 |
| LEAP-Seq n confirming: | 1705 |
| LEAP-Seq n nonconfirming: | 9 |
| LEAP-Seq n unique pos: | 7 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ATGTGACATCAGGCTTGTGC |
| Suggested primer 2: | CGATGCGTATGTCCAACATC |