| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.252335 |
| Chromosome: | chromosome 1 |
| Location: | 4334750 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g029350 | C1d-87,FAP297 | Flagellar central pair-associated protein 297; (1 of 1) IPR006885//IPR017986 - NADH dehydrogenase ubiquinone Fe-S protein 4, mitochondrial // WD40-repeat-containing domain | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGCGTCAAGTAGCCTTGTTTTACGTGAGGC |
| Internal bar code: | GTGGCCTCAGGGTAGGACATAC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 601 |
| LEAP-Seq percent confirming: | 99.4076 |
| LEAP-Seq n confirming: | 839 |
| LEAP-Seq n nonconfirming: | 5 |
| LEAP-Seq n unique pos: | 21 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TAGCTGGAGAGGGGTAGCAA |
| Suggested primer 2: | GCTGCCTTTATGGTAATGCG |