| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.252336 |
| Chromosome: | chromosome 2 |
| Location: | 7402380 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g144650 | PTB12 | (1 of 9) K14640 - solute carrier family 20 (sodium-dependent phosphate transporter) (SLC20A, PIT); Sodium/phosphate symporter | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTGTCTTGCCCCTGCGTTCTCACGTCATTG |
| Internal bar code: | TATGGGAAATGGCCAGAAGCGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 548 |
| LEAP-Seq percent confirming: | 94.8718 |
| LEAP-Seq n confirming: | 222 |
| LEAP-Seq n nonconfirming: | 12 |
| LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACCTGGCTTTACATTGCCAC |
| Suggested primer 2: | CCATTTTAACGGCACGAAGT |