| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.252467 |
| Chromosome: | chromosome 16 |
| Location: | 6597670 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g672200 | BALD11,BLD11 | (1 of 1) PF14309 - Domain of unknown function (DUF4378) (DUF4378); Bald 11 | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGCTGCGCCTCGCTGGCGTCCACCAGCCGC |
| Internal bar code: | GTAGCTTAATTACACTGGGAGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 277 |
| LEAP-Seq percent confirming: | 99.0476 |
| LEAP-Seq n confirming: | 1144 |
| LEAP-Seq n nonconfirming: | 11 |
| LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACCCTGAACCTCCTGTCCTT |
| Suggested primer 2: | TCCGTCAACCCACACTGTTA |