| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.252641 |
| Chromosome: | chromosome 9 |
| Location: | 7032693 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g411200 | PSB33,TEF5,LIL8 | PSII assembly protein; (1 of 1) PTHR21496:SF0 - RIESKE DOMAIN-CONTAINING PROTEIN | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCCGCAGCCACTTTTCTACTATGTGCTTGC |
| Internal bar code: | CTACCATCGTTCGAATCATTAT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 861 |
| LEAP-Seq percent confirming: | 99.3831 |
| LEAP-Seq n confirming: | 3222 |
| LEAP-Seq n nonconfirming: | 20 |
| LEAP-Seq n unique pos: | 10 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TTGCGTGAGGGTCTACACTG |
| Suggested primer 2: | TATGATAAGCGTGCGACTGC |