| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.252697 |
| Chromosome: | chromosome 3 |
| Location: | 5013692 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g180550 | FPN2,NTD5 | (1 of 3) K01081 - 5'-nucleotidase (E3.1.3.5); Flagellar Associated 5'-nucleotidase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGCAGACGTGTAGCGCCCGTGCCGCCCCAC |
| Internal bar code: | TGGCTATCAGCTCGATCGGTCG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 518 |
| LEAP-Seq percent confirming: | 97.9592 |
| LEAP-Seq n confirming: | 192 |
| LEAP-Seq n nonconfirming: | 4 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCCATGTACTCCTTCACGGT |
| Suggested primer 2: | CGCCCTTCGTTATGCAGTAT |